BioLiP

>rna
uuggaaaagauuagcauggccccugcgcaaggaugacauucgugaagcguauuu

The query sequence (length=54) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8h6j:6A	54	54	1.0000	1.0000	1.0000	4.78e-23
2	8rm5:6	64	51	0.9259	0.7812	0.9804	1.03e-19
3	8r09:6	65	51	0.9259	0.7692	0.9804	1.03e-19	8r0b:6
4	8h6k:6A	60	51	0.9259	0.8333	0.9804	1.03e-19
5	8h6e:6A	59	51	0.9259	0.8475	0.9804	1.03e-19	8h6l:6A, 8qzs:6
6	6ahd:F	94	51	0.9259	0.5319	0.9804	1.03e-19	8qo9:6
7	6qx9:6	53	54	0.9630	0.9811	0.9630	3.72e-19	8qxd:6, 8r08:6
8	5o9z:6	90	47	0.8519	0.5111	0.9787	1.73e-17
9	6ah0:F	69	48	0.8519	0.6667	0.9583	8.05e-16
10	6qw6:6	42	40	0.7407	0.9524	1.0000	2.89e-15
11	5z56:F	93	49	0.8519	0.4946	0.9388	1.04e-14	5z57:F, 5z58:F
12	8r0a:6	59	51	0.8704	0.7966	0.9216	1.35e-13
13	8qp8:6	37	37	0.6852	1.0000	1.0000	1.35e-13	8qp9:6
14	8ch6:d	93	49	0.8333	0.4839	0.9184	4.84e-13	7qtt:d
15	6zym:6	79	35	0.6296	0.4304	0.9714	8.11e-11
16	8ro1:6	101	35	0.6296	0.3366	0.9714	8.11e-11
17	8ro0:6	90	35	0.6296	0.3778	0.9714	8.11e-11
18	8qpe:6	43	35	0.6296	0.7907	0.9714	8.11e-11
19	8qpa:6	47	35	0.6296	0.7234	0.9714	8.11e-11
20	8qoz:6	48	35	0.6296	0.7083	0.9714	8.11e-11	8qpb:6
21	8q7n:6	78	35	0.6296	0.4359	0.9714	8.11e-11
22	5mqf:6	89	35	0.6296	0.3820	0.9714	8.11e-11
23	6ff4:6	95	35	0.6296	0.3579	0.9714	8.11e-11	6ff7:6, 8i0p:F
24	8c6j:6	97	35	0.6296	0.3505	0.9714	8.11e-11	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
25	8qpk:6	43	33	0.5926	0.7442	0.9697	1.05e-09

[Back]