acgaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucuuuucaacauuuuuuggcaccgcgacccucgcac
uuguggagucg
The query sequence (length=91) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5wsg:L | 91 | 91 | 1.0000 | 1.0000 | 1.0000 | 2.58e-43 | 5ylz:F |
2 | 5y88:F | 82 | 91 | 0.9011 | 1.0000 | 0.9011 | 1.58e-25 | |
3 | 6j6q:L | 210 | 52 | 0.5714 | 0.2476 | 1.0000 | 1.23e-21 | |
4 | 6j6h:L | 209 | 52 | 0.5714 | 0.2488 | 1.0000 | 1.23e-21 | |
5 | 6j6g:L | 208 | 52 | 0.5714 | 0.2500 | 1.0000 | 1.23e-21 | |
6 | 5gm6:L | 66 | 52 | 0.5714 | 0.7879 | 1.0000 | 1.23e-21 | |
7 | 7dco:H | 169 | 52 | 0.5714 | 0.3077 | 1.0000 | 1.23e-21 | |
8 | 5lqw:2 | 81 | 50 | 0.5495 | 0.6173 | 1.0000 | 1.60e-20 | |
9 | 5mq0:2 | 155 | 49 | 0.5385 | 0.3161 | 1.0000 | 5.74e-20 | |
10 | 5mps:2 | 49 | 49 | 0.5385 | 1.0000 | 1.0000 | 5.74e-20 | |
11 | 5gmk:L | 127 | 49 | 0.5385 | 0.3858 | 1.0000 | 5.74e-20 | |
12 | 5gmk:L | 127 | 39 | 0.4286 | 0.3071 | 1.0000 | 2.08e-14 | |
13 | 6exn:2 | 136 | 54 | 0.5714 | 0.3824 | 0.9630 | 2.06e-19 | |
14 | 5lj3:Z | 171 | 53 | 0.5604 | 0.2982 | 0.9623 | 2.67e-18 | 5lj5:Z |
15 | 6j6n:L | 205 | 46 | 0.5055 | 0.2244 | 1.0000 | 2.67e-18 | |
16 | 6bk8:2 | 135 | 45 | 0.4945 | 0.3333 | 1.0000 | 9.60e-18 | |
17 | 7b9v:2 | 196 | 52 | 0.5495 | 0.2551 | 0.9615 | 9.60e-18 | |
18 | 3jb9:P | 111 | 44 | 0.4725 | 0.3874 | 0.9773 | 5.78e-15 |