Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●D-I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●D-QUARK ●DRfold ●DRfold2 ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred ●TCRfinder

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●DeepMSA2 ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP Library
>rna
acgaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucuuuucaacauuuuuuggcaccgcgacccucgcac
uuguggagucg

The query sequence (length=91) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5wsg:L 91 91 1.0000 1.0000 1.0000 2.58e-43 5ylz:F
2 5y88:F 82 91 0.9011 1.0000 0.9011 1.58e-25
3 6j6q:L 210 52 0.5714 0.2476 1.0000 1.23e-21
4 6j6h:L 209 52 0.5714 0.2488 1.0000 1.23e-21
5 6j6g:L 208 52 0.5714 0.2500 1.0000 1.23e-21
6 5gm6:L 66 52 0.5714 0.7879 1.0000 1.23e-21
7 7dco:H 169 52 0.5714 0.3077 1.0000 1.23e-21
8 5lqw:2 81 50 0.5495 0.6173 1.0000 1.60e-20
9 5mq0:2 155 49 0.5385 0.3161 1.0000 5.74e-20
10 5mps:2 49 49 0.5385 1.0000 1.0000 5.74e-20
11 5gmk:L 127 49 0.5385 0.3858 1.0000 5.74e-20
12 5gmk:L 127 39 0.4286 0.3071 1.0000 2.08e-14
13 6exn:2 136 54 0.5714 0.3824 0.9630 2.06e-19
14 5lj3:Z 171 53 0.5604 0.2982 0.9623 2.67e-18 5lj5:Z
15 6j6n:L 205 46 0.5055 0.2244 1.0000 2.67e-18
16 6bk8:2 135 45 0.4945 0.3333 1.0000 9.60e-18
17 7b9v:2 196 52 0.5495 0.2551 0.9615 9.60e-18
18 3jb9:P 111 44 0.4725 0.3874 0.9773 5.78e-15

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417