gtccaggttctccctgtggtgaaaaccaactaa
The query sequence (length=33) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6rny:J | 53 | 33 | 1.0000 | 0.6226 | 1.0000 | 6.55e-13 | |
| 2 | 6rny:T | 33 | 33 | 1.0000 | 1.0000 | 1.0000 | 6.55e-13 | |
| 3 | 6r0c:J | 142 | 31 | 0.9394 | 0.2183 | 1.0000 | 8.48e-12 | |
| 4 | 6r0c:I | 142 | 31 | 0.9394 | 0.2183 | 1.0000 | 8.48e-12 |
zhanggroup.org