cagggctgatcgtgcaaaagtcgtgccagccgtct
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7qwp:N | 36 | 35 | 1.0000 | 0.9722 | 1.0000 | 5.60e-14 | 7qxi:N |
| 2 | 7qv9:T | 36 | 35 | 1.0000 | 0.9722 | 1.0000 | 5.60e-14 | 7qwp:T, 7qxi:T |
| 3 | 5nss:H | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | |
| 4 | 6gh6:T | 48 | 34 | 0.9714 | 0.7083 | 1.0000 | 2.01e-13 | |
| 5 | 6gh5:F | 46 | 30 | 0.8571 | 0.6522 | 1.0000 | 3.37e-11 | |
| 6 | 6gfw:F | 50 | 30 | 0.8571 | 0.6000 | 1.0000 | 3.37e-11 |
zhanggroup.org