Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●D-I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●D-QUARK ●DRfold ●DRfold2 ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred ●TCRfinder

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●DeepMSA2 ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP Library
Download all results in tab-seperated text for 3 receptor-ligand interactions, whose format is explained at readme.txt.
  • Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.
  • Click Site # to view the binding site structure. Hover over Site # to view the binding residues.
  • The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.
  • Hover over EC number to view the full name of enzymatic activity.
  • Hover over GO terms to view all GO terms.
  • Hover over UniProt to view the protein name.

    • Sort results by
    << < 1 > >>
    Go to page

    # PDB
    (resolution)     		Site
    #     		DNA
    sequence         		EC
    number     		GO
    terms     		UniProt PubMed Binding
    affinity
    1 8eza:A
    (4.39)    		 BS02 >8eza:D (identical to 8eza:M, 8ezb:D, 8ezb:M, 7lt3:D, 7lt3:M)
    tctaagaactctgatgtcagtagattacact
    		 3.6.4.-
    4.2.99.-    		 GO:0000723 ... P12956 37256947
    2 8eza:B
    (4.39)    		 BS01 >8eza:D (identical to 8eza:M, 8ezb:D, 8ezb:M, 7lt3:D, 7lt3:M)
    tctaagaactctgatgtcagtagattacact
    		 3.6.4.- GO:0000723 ... P13010 37256947
    3 8eza:C
    (4.39)    		 BS02 >8eza:D (identical to 8eza:M, 8ezb:D, 8ezb:M, 7lt3:D, 7lt3:M)
    tctaagaactctgatgtcagtagattacact
    		 2.7.11.1 GO:0000460 ... P78527 37256947
    Reference:
    • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
    • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417