BioLiP

>rna
ugguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucugagucuuaaccc
aauuuuuugaggccuugc

The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6id0:B	98	98	1.0000	1.0000	1.0000	3.63e-47	6id1:B
2	8h6e:5A	114	98	1.0000	0.8596	1.0000	3.63e-47	8h6j:5A
3	6ah0:B	115	98	1.0000	0.8522	1.0000	3.63e-47	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
4	6icz:B	97	97	0.9898	1.0000	1.0000	1.31e-46
5	8c6j:5	113	98	0.9898	0.8584	0.9898	6.08e-45
6	7abg:5	114	98	0.9898	0.8509	0.9898	6.08e-45	7abi:5, 5mqf:5, 5o9z:5
7	8r09:5	112	98	0.9694	0.8482	0.9694	4.73e-41	8r0b:5, 8rm5:5
8	8qzs:5	109	98	0.9388	0.8440	0.9388	1.71e-35	8y6o:B
9	8qoz:5	79	75	0.7653	0.9494	1.0000	2.22e-34	8qpa:5, 8qpb:5
10	8qpk:5	77	73	0.7449	0.9481	1.0000	2.87e-33
11	6zym:5	74	71	0.7245	0.9595	1.0000	3.71e-32
12	7aav:5	69	69	0.7041	1.0000	1.0000	4.80e-31
13	6ff4:5	70	68	0.6939	0.9714	1.0000	1.73e-30	6ff7:5
14	8ch6:e	98	70	0.7041	0.7041	0.9857	2.23e-29	7qtt:e
15	7w59:B	84	64	0.6531	0.7619	1.0000	2.89e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
16	8i0p:B	98	64	0.6531	0.6531	1.0000	2.89e-28	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
17	7dvq:B	90	64	0.6531	0.7111	1.0000	2.89e-28
18	6qdv:5	75	63	0.6429	0.8400	1.0000	1.04e-27
19	9fmd:5	92	61	0.6224	0.6630	1.0000	1.34e-26	8ro2:5
20	8q7q:5	104	98	0.8878	0.8365	0.8878	1.74e-25	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
21	7abf:5	58	58	0.5918	1.0000	1.0000	6.25e-25
22	8qp8:5	71	72	0.6837	0.9437	0.9306	1.05e-22	8qp9:5
23	8ro1:5	111	52	0.4694	0.4144	0.8846	4.94e-11
24	8ro0:5	111	52	0.4694	0.4144	0.8846	4.94e-11

[Back]