BioLiP

>rna
uccucgaggaggauuuuuggagcagggagauggaauaggagcuugcuccguccacuccacgcaucgaccugguauugcag
uaccuccaggaacggugc

The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6y53:2	98	98	1.0000	1.0000	1.0000	3.63e-47
2	7vpx:H	130	98	1.0000	0.7538	1.0000	3.63e-47
3	7evo:H	148	98	1.0000	0.6622	1.0000	3.63e-47	8hk1:H, 6y5q:2
4	8i0r:H	167	97	0.9796	0.5749	0.9897	2.19e-44	8i0s:H, 8i0t:H, 8i0u:H
5	8i0p:H	165	97	0.9796	0.5818	0.9897	2.19e-44
6	7abi:2	164	100	1.0000	0.5976	0.9800	2.19e-44
7	7abg:2	145	100	1.0000	0.6759	0.9800	2.19e-44
8	8i0v:H	151	88	0.8980	0.5828	1.0000	1.32e-41
9	7a5p:2	155	88	0.8980	0.5677	1.0000	1.32e-41
10	5mqf:2	140	49	0.5000	0.3500	1.0000	6.30e-20
11	8c6j:2	142	49	0.5000	0.3451	1.0000	6.30e-20
12	5o9z:2	100	48	0.4898	0.4800	1.0000	2.26e-19
13	5z56:H	136	42	0.4286	0.3088	1.0000	4.90e-16	5z57:H, 5z58:H
14	6icz:H	140	42	0.4286	0.3000	1.0000	4.90e-16	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
15	8i0w:H	139	42	0.4286	0.3022	1.0000	4.90e-16	5yzg:H
16	8ch6:f	137	42	0.4286	0.3066	1.0000	4.90e-16
17	6ah0:H	109	42	0.4286	0.3853	1.0000	4.90e-16	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
18	8r09:2	98	38	0.3878	0.3878	1.0000	8.20e-14	8r0b:2, 8rm5:2
19	8r08:2	97	38	0.3878	0.3918	1.0000	8.20e-14	8r0a:2
20	8qxd:2	97	38	0.3878	0.3918	1.0000	8.20e-14
21	6qx9:2	94	38	0.3878	0.4043	1.0000	8.20e-14
22	8qo9:2	98	38	0.3878	0.3878	1.0000	8.20e-14	8qzs:2
23	6id1:H	136	38	0.3878	0.2794	1.0000	8.20e-14
24	6id0:H	140	38	0.3878	0.2714	1.0000	8.20e-14
25	9fmd:2	120	38	0.3878	0.3167	1.0000	8.20e-14	6qdv:2

[Back]