uccucgaggaggauuuuuggagcagggagauggaauaggagcuugcuccguccacuccacgcaucgaccugguauugcag
uaccuccaggaacggugc
The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6y53:2 | 98 | 98 | 1.0000 | 1.0000 | 1.0000 | 3.63e-47 | |
2 | 7vpx:H | 130 | 98 | 1.0000 | 0.7538 | 1.0000 | 3.63e-47 | |
3 | 7evo:H | 148 | 98 | 1.0000 | 0.6622 | 1.0000 | 3.63e-47 | 8hk1:H, 6y5q:2 |
4 | 8i0r:H | 167 | 97 | 0.9796 | 0.5749 | 0.9897 | 2.19e-44 | 8i0s:H, 8i0t:H, 8i0u:H |
5 | 8i0p:H | 165 | 97 | 0.9796 | 0.5818 | 0.9897 | 2.19e-44 | |
6 | 7abi:2 | 164 | 100 | 1.0000 | 0.5976 | 0.9800 | 2.19e-44 | |
7 | 7abg:2 | 145 | 100 | 1.0000 | 0.6759 | 0.9800 | 2.19e-44 | |
8 | 8i0v:H | 151 | 88 | 0.8980 | 0.5828 | 1.0000 | 1.32e-41 | |
9 | 7a5p:2 | 155 | 88 | 0.8980 | 0.5677 | 1.0000 | 1.32e-41 | |
10 | 5mqf:2 | 140 | 49 | 0.5000 | 0.3500 | 1.0000 | 6.30e-20 | |
11 | 8c6j:2 | 142 | 49 | 0.5000 | 0.3451 | 1.0000 | 6.30e-20 | |
12 | 5o9z:2 | 100 | 48 | 0.4898 | 0.4800 | 1.0000 | 2.26e-19 | |
13 | 5z56:H | 136 | 42 | 0.4286 | 0.3088 | 1.0000 | 4.90e-16 | 5z57:H, 5z58:H |
14 | 6icz:H | 140 | 42 | 0.4286 | 0.3000 | 1.0000 | 4.90e-16 | 7w59:H, 7w5a:H, 7w5b:H, 5xjc:H |
15 | 8i0w:H | 139 | 42 | 0.4286 | 0.3022 | 1.0000 | 4.90e-16 | 5yzg:H |
16 | 8ch6:f | 137 | 42 | 0.4286 | 0.3066 | 1.0000 | 4.90e-16 | |
17 | 6ah0:H | 109 | 42 | 0.4286 | 0.3853 | 1.0000 | 4.90e-16 | 6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A |
18 | 8r09:2 | 98 | 38 | 0.3878 | 0.3878 | 1.0000 | 8.20e-14 | 8r0b:2, 8rm5:2 |
19 | 8r08:2 | 97 | 38 | 0.3878 | 0.3918 | 1.0000 | 8.20e-14 | 8r0a:2 |
20 | 8qxd:2 | 97 | 38 | 0.3878 | 0.3918 | 1.0000 | 8.20e-14 | |
21 | 6qx9:2 | 94 | 38 | 0.3878 | 0.4043 | 1.0000 | 8.20e-14 | |
22 | 8qo9:2 | 98 | 38 | 0.3878 | 0.3878 | 1.0000 | 8.20e-14 | 8qzs:2 |
23 | 6id1:H | 136 | 38 | 0.3878 | 0.2794 | 1.0000 | 8.20e-14 | |
24 | 6id0:H | 140 | 38 | 0.3878 | 0.2714 | 1.0000 | 8.20e-14 | |
25 | 9fmd:2 | 120 | 38 | 0.3878 | 0.3167 | 1.0000 | 8.20e-14 | 6qdv:2 |