uccgugauaguuuaauggucagaaugggcgcuugucgcgugccagaucgggguucaauuccccgucgcggagcca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1asy:R | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 1asy:S, 1asz:R, 1asz:S, 1il2:C, 3j16:L, 4v6i:CB |
| 2 | 1il2:D | 70 | 70 | 0.9333 | 1.0000 | 1.0000 | 9.46e-32 | |
| 3 | 1jgo:D | 74 | 30 | 0.4000 | 0.4054 | 1.0000 | 1.63e-09 | 1jgp:D, 1jgq:D, 2om7:M, 4v42:AD |
umich.edu