uccgauauagcguaacggcuaucacaucacgcuuucaccguggagaccgggguucgacuccccguaucggagcca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6i7o:m | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 7old:5, 6q8y:m, 7qvp:CC, 6t4q:7, 6t7i:7, 7xnx:CC, 6z6l:CC, 6z6n:CC, 6zm7:CC, 6zme:CC, 6zmi:CC, 6zmo:CC, 7zrs:6, 6zvh:x |
zhanggroup.org