uccaccaaaguuaucgcuuuggucaauuaaugcagagcaacauccagcaaaca
The query sequence (length=53) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 9cf0:W | 53 | 53 | 1.0000 | 1.0000 | 1.0000 | 1.67e-22 | |
| 2 | 9cf2:W | 58 | 56 | 1.0000 | 0.9138 | 0.9464 | 4.68e-18 | 9cf3:W |
| 3 | 9cf1:W | 50 | 50 | 0.8868 | 0.9400 | 0.9400 | 1.01e-14 |
zhanggroup.org