uacuguccaaugagcgcauagugagggcagua
The query sequence (length=32) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8y6o:J | 108 | 32 | 1.0000 | 0.2963 | 1.0000 | 3.38e-11 | |
| 2 | 3siv:C | 32 | 32 | 1.0000 | 1.0000 | 1.0000 | 3.38e-11 | 3siv:F, 3siv:I, 3siv:L |
| 3 | 3siu:C | 28 | 28 | 0.8750 | 1.0000 | 1.0000 | 5.66e-09 | 3siu:F |
zhanggroup.org