uacgucccucuccaaacgagagaacaugcaugggcuggcaugagcgguggggcucgucccgaggcgcugaaccuugaggc
cugcaugcucagggacac
The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8a3w:5 | 98 | 98 | 1.0000 | 1.0000 | 1.0000 | 3.63e-47 | |
2 | 6az3:5 | 97 | 98 | 0.9796 | 0.9897 | 0.9796 | 2.83e-43 | |
3 | 5t2a:H | 93 | 95 | 0.9082 | 0.9570 | 0.9368 | 2.22e-34 | |
4 | 5t5h:H | 91 | 89 | 0.8469 | 0.9121 | 0.9326 | 1.73e-30 | |
5 | 8a98:5 | 111 | 111 | 1.0000 | 0.8829 | 0.8829 | 8.03e-29 | |
6 | 8ovj:5 | 115 | 115 | 1.0000 | 0.8522 | 0.8522 | 2.91e-23 | |
7 | 8rxh:L5 | 120 | 97 | 0.8469 | 0.6917 | 0.8557 | 2.26e-19 | |
8 | 8rxx:L5 | 122 | 47 | 0.4796 | 0.3852 | 1.0000 | 8.14e-19 | |
9 | 8rxx:L5 | 122 | 29 | 0.2959 | 0.2377 | 1.0000 | 8.26e-09 | |
10 | 3jcs:5 | 80 | 47 | 0.4796 | 0.5875 | 1.0000 | 8.14e-19 |