uacgucccucuccaaacgagagaacaugcaugggcuggcaugagcggccuugaggccugaaauuucaugcuagggacaca
The query sequence (length=80) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3jcs:5 | 80 | 80 | 1.0000 | 1.0000 | 1.0000 | 2.84e-37 | |
2 | 8rxx:L5 | 122 | 48 | 0.6000 | 0.3934 | 1.0000 | 1.75e-19 | |
3 | 8rxh:L5 | 120 | 48 | 0.6000 | 0.4000 | 1.0000 | 1.75e-19 | |
4 | 8ovj:5 | 115 | 48 | 0.6000 | 0.4174 | 1.0000 | 1.75e-19 | |
5 | 8a98:5 | 111 | 48 | 0.6000 | 0.4324 | 1.0000 | 1.75e-19 | |
6 | 6az3:5 | 97 | 47 | 0.5875 | 0.4845 | 1.0000 | 6.29e-19 | |
7 | 8a3w:5 | 98 | 47 | 0.5875 | 0.4796 | 1.0000 | 6.29e-19 | |
8 | 5t5h:H | 91 | 45 | 0.5625 | 0.4945 | 1.0000 | 8.13e-18 | |
9 | 5t2a:H | 93 | 45 | 0.5625 | 0.4839 | 1.0000 | 8.13e-18 |