guucgcgaacuucguggacauuuggucaauuugaaacaauacagagaucagcaguuccccugcauaaggaugaaccguuc
aaagagauuuguuuu
The query sequence (length=95) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5nrl:6 | 95 | 95 | 1.0000 | 1.0000 | 1.0000 | 1.63e-45 | |
2 | 5zwm:F | 99 | 87 | 0.8947 | 0.8586 | 0.9770 | 3.54e-37 | 5zwo:F |
3 | 5mps:6 | 99 | 97 | 0.9474 | 0.9091 | 0.9278 | 9.92e-33 | 5mq0:6 |
4 | 5lj3:V | 97 | 97 | 0.9474 | 0.9278 | 0.9278 | 9.92e-33 | 5lj5:V |
5 | 7dco:F | 103 | 87 | 0.8526 | 0.7864 | 0.9310 | 2.15e-29 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
6 | 7b9v:6 | 102 | 87 | 0.8526 | 0.7941 | 0.9310 | 2.15e-29 | 6bk8:6, 6exn:6, 5lqw:6 |
7 | 5y88:D | 101 | 86 | 0.8421 | 0.7921 | 0.9302 | 7.72e-29 | |
8 | 5gan:W | 80 | 79 | 0.7895 | 0.9375 | 0.9494 | 7.72e-29 | |
9 | 5tf6:B | 71 | 70 | 0.6737 | 0.9014 | 0.9143 | 6.06e-20 | |
10 | 5gap:W | 56 | 60 | 0.5895 | 1.0000 | 0.9333 | 2.82e-18 | |
11 | 3jcm:D | 45 | 41 | 0.4316 | 0.9111 | 1.0000 | 1.70e-15 |