guuacggcgguccauagcggcagggaaacgcccggucccaucccgaacccggaagcuaagccugccagcgccgaugauac
uacccauccggguggaaaaguaggacaccgccgaacac
The query sequence (length=118) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6dzi:B | 118 | 118 | 1.0000 | 1.0000 | 1.0000 | 3.47e-58 | 6dzp:B, 8fr8:B, 8kab:B, 5o60:B, 5o61:B, 7s0s:i, 8v9j:B, 8v9k:B, 8v9l:B, 8wi7:B, 8wi8:B, 7xam:B, 8xz3:B, 7y41:B |
2 | 8whx:B | 117 | 117 | 0.9915 | 1.0000 | 1.0000 | 1.25e-57 | 8why:B, 8wib:B, 8wic:B |
3 | 5zeb:B | 117 | 117 | 0.9831 | 0.9915 | 0.9915 | 5.80e-56 | 5zep:B, 5zet:B |
4 | 5xym:B | 116 | 116 | 0.9746 | 0.9914 | 0.9914 | 2.09e-55 | |
5 | 7f0d:B | 115 | 116 | 0.9407 | 0.9652 | 0.9569 | 3.52e-48 | 7kgb:B, 7msc:B, 7msh:B, 7msm:B, 7msz:B, 7mt2:B, 7mt3:B, 7mt7:B, 7sfr:B, 5v7q:B, 5v93:B |