guuaaaacucuucucaugcuggauucgaaauuaggugcgcuucgcguu
The query sequence (length=48) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8z9c:M | 48 | 48 | 1.0000 | 1.0000 | 1.0000 | 8.61e-20 | |
| 2 | 8z99:M | 54 | 48 | 1.0000 | 0.8889 | 1.0000 | 8.61e-20 | |
| 3 | 8z4l:M | 49 | 48 | 1.0000 | 0.9796 | 1.0000 | 8.61e-20 | |
| 4 | 8yhd:M | 53 | 48 | 1.0000 | 0.9057 | 1.0000 | 8.61e-20 | |
| 5 | 8yhe:M | 46 | 46 | 0.9583 | 1.0000 | 1.0000 | 1.11e-18 | |
| 6 | 8z9e:M | 39 | 39 | 0.8125 | 1.0000 | 1.0000 | 8.68e-15 | |
| 7 | 8z99:N | 46 | 39 | 0.8125 | 0.8478 | 1.0000 | 8.68e-15 | |
| 8 | 8z4j:M | 38 | 38 | 0.7917 | 1.0000 | 1.0000 | 3.12e-14 | |
| 9 | 8z9c:N | 41 | 35 | 0.7292 | 0.8537 | 1.0000 | 1.45e-12 | |
| 10 | 8z4l:N | 40 | 34 | 0.7083 | 0.8500 | 1.0000 | 5.22e-12 | |
| 11 | 8yhd:N | 35 | 34 | 0.7083 | 0.9714 | 1.0000 | 5.22e-12 | |
| 12 | 8z4j:N | 34 | 28 | 0.5833 | 0.8235 | 1.0000 | 1.13e-08 | 8z9e:N |
| 13 | 8yhe:N | 30 | 28 | 0.5833 | 0.9333 | 1.0000 | 1.13e-08 |
zhanggroup.org