BioLiP

>rna
gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauggccccugcgcaaggaugacacg
caaauucgugaagcguu

The query sequence (length=97) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8c6j:6	97	97	1.0000	1.0000	1.0000	1.29e-46	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
2	6ff4:6	95	95	0.9794	1.0000	1.0000	1.67e-45	6ff7:6, 8i0p:F
3	5z56:F	93	97	0.9588	1.0000	0.9588	7.82e-39	5z57:F, 5z58:F
4	8ch6:d	93	97	0.9588	1.0000	0.9588	7.82e-39	7qtt:d
5	7abi:6	91	95	0.9381	1.0000	0.9579	1.01e-37
6	6zym:6	79	79	0.8144	1.0000	1.0000	1.31e-36
7	8q7n:6	78	78	0.8041	1.0000	1.0000	4.70e-36
8	5o9z:6	90	78	0.8041	0.8667	1.0000	4.70e-36
9	6ahd:F	94	78	0.8041	0.8298	1.0000	4.70e-36	8qo9:6
10	8ro1:6	101	90	0.8866	0.8515	0.9556	1.69e-35
11	8ro0:6	90	88	0.8660	0.9333	0.9545	2.19e-34
12	5mqf:6	89	96	0.9175	1.0000	0.9271	3.66e-32
13	7aav:6	73	75	0.7526	1.0000	0.9733	1.70e-30
14	8r09:6	65	48	0.4948	0.7385	1.0000	2.24e-19	8r0b:6
15	8qoz:6	48	48	0.4948	1.0000	1.0000	2.24e-19	8qpb:6
16	8rm5:6	64	47	0.4845	0.7344	1.0000	8.04e-19
17	8qpa:6	47	47	0.4845	1.0000	1.0000	8.04e-19
18	3jb9:N	90	52	0.5155	0.5556	0.9615	2.89e-18
19	7abg:6	78	46	0.4742	0.5897	1.0000	2.89e-18
20	7abf:6	65	46	0.4742	0.7077	1.0000	2.89e-18
21	8h6k:6A	60	44	0.4536	0.7333	1.0000	3.74e-17
22	8qpe:6	43	43	0.4433	1.0000	1.0000	1.35e-16
23	8h6e:6A	59	43	0.4433	0.7288	1.0000	1.35e-16	8h6l:6A, 8qzs:6
24	8r0a:6	59	38	0.3918	0.6441	1.0000	8.10e-14
25	8qpk:6	43	38	0.3918	0.8837	1.0000	8.10e-14
26	6qw6:6	42	35	0.3505	0.8095	0.9714	1.75e-10
27	8h6j:6A	54	35	0.3505	0.6296	0.9714	1.75e-10
28	6ah0:F	69	35	0.3505	0.4928	0.9714	1.75e-10
29	6qx9:6	53	34	0.3402	0.6226	0.9706	6.30e-10	8qxd:6, 8r08:6
30	8qp8:6	37	34	0.3402	0.8919	0.9706	6.30e-10	8qp9:6

[Back]