BioLiP

>rna
gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauggccccugcgcaaggaugacacg
caaauucgugaagcg

The query sequence (length=95) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6ff4:6	95	95	1.0000	1.0000	1.0000	1.63e-45	6ff7:6, 8i0p:F
2	8c6j:6	97	95	1.0000	0.9794	1.0000	1.63e-45	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
3	5z56:F	93	95	0.9579	0.9785	0.9579	9.85e-38	5z57:F, 5z58:F
4	8ch6:d	93	81	0.8526	0.8710	1.0000	9.85e-38	7qtt:d
5	7abi:6	91	95	0.9579	1.0000	0.9579	9.85e-38
6	6zym:6	79	79	0.8316	1.0000	1.0000	1.27e-36
7	8q7n:6	78	78	0.8211	1.0000	1.0000	4.58e-36
8	5o9z:6	90	78	0.8211	0.8667	1.0000	4.58e-36
9	6ahd:F	94	78	0.8211	0.8298	1.0000	4.58e-36	8qo9:6
10	8ro1:6	101	88	0.8842	0.8317	0.9545	2.13e-34
11	8ro0:6	90	88	0.8842	0.9333	0.9545	2.13e-34
12	5mqf:6	89	95	0.9263	0.9888	0.9263	1.28e-31
13	7aav:6	73	75	0.7684	1.0000	0.9733	1.66e-30
14	8r09:6	65	48	0.5053	0.7385	1.0000	2.18e-19	8r0b:6
15	8qoz:6	48	48	0.5053	1.0000	1.0000	2.18e-19	8qpb:6
16	8rm5:6	64	47	0.4947	0.7344	1.0000	7.84e-19
17	8qpa:6	47	47	0.4947	1.0000	1.0000	7.84e-19
18	3jb9:N	90	52	0.5263	0.5556	0.9615	2.82e-18
19	7abg:6	78	46	0.4842	0.5897	1.0000	2.82e-18
20	7abf:6	65	46	0.4842	0.7077	1.0000	2.82e-18
21	8h6k:6A	60	44	0.4632	0.7333	1.0000	3.65e-17
22	8qpe:6	43	43	0.4526	1.0000	1.0000	1.31e-16
23	8h6e:6A	59	43	0.4526	0.7288	1.0000	1.31e-16	8h6l:6A, 8qzs:6
24	8r0a:6	59	38	0.4000	0.6441	1.0000	7.89e-14
25	8qpk:6	43	38	0.4000	0.8837	1.0000	7.89e-14
26	6qw6:6	42	35	0.3579	0.8095	0.9714	1.71e-10
27	8h6j:6A	54	35	0.3579	0.6296	0.9714	1.71e-10
28	6ah0:F	69	35	0.3579	0.4928	0.9714	1.71e-10
29	6qx9:6	53	34	0.3474	0.6226	0.9706	6.14e-10	8qxd:6, 8r08:6
30	8qp8:6	37	34	0.3474	0.8919	0.9706	6.14e-10	8qp9:6

[Back]