BioLiP

>rna
gucgacguacuucauaggaucauuucuauaggaaucgucacucuuugacucuucaaaagagccacugaauccaacuuggu
ugaugagucccauaaccuuuguaccccagagugagaaauugccguugcauuuuauggcgcgaugaucuugacccauccua
uagggggguggguacaaauggcagucugacaagu

The query sequence (length=194) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6lqt:3A	194	194	1.0000	1.0000	1.0000	3.44e-100
2	7d5s:3A	175	194	0.9021	1.0000	0.9021	6.04e-63	7d63:3A, 6ke6:3A, 6lqp:3A, 6lqq:3A, 6lqr:3A, 6lqu:3A, 6lqv:3A
3	6zqa:D4	175	194	0.8969	0.9943	0.8969	2.81e-61	6zqb:D4
4	6lqs:3A	234	119	0.6134	0.5085	1.0000	1.69e-58
5	6lqs:3A	234	87	0.3969	0.3291	0.8851	2.98e-21
6	7suk:L2	169	118	0.5928	0.6805	0.9746	7.93e-52	5wlc:L2
7	7suk:L2	169	29	0.1495	0.1716	1.0000	1.82e-08	5wlc:L2
8	6zqc:D4	230	106	0.5464	0.4609	1.0000	2.85e-51
9	6zqc:D4	230	29	0.1495	0.1261	1.0000	1.82e-08
10	7ajt:D4	230	106	0.5464	0.4609	1.0000	2.85e-51
11	7ajt:D4	230	29	0.1495	0.1261	1.0000	1.82e-08
12	7d5t:3A	167	193	0.8608	1.0000	0.8653	4.77e-49
13	6zqd:D4	223	119	0.5619	0.4888	0.9160	4.84e-39	6zqe:D4
14	6zqd:D4	223	29	0.1495	0.1300	1.0000	1.82e-08	6zqe:D4
15	7aju:D4	223	119	0.5619	0.4888	0.9160	4.84e-39
16	7aju:D4	223	29	0.1495	0.1300	1.0000	1.82e-08
17	6nd4:2	146	89	0.4433	0.5890	0.9663	1.05e-35
18	6nd4:2	146	29	0.1495	0.1986	1.0000	1.82e-08
19	5wyj:3A	157	157	0.6856	0.8471	0.8471	6.30e-33	5wyk:3A
20	7d4i:3A	216	117	0.5155	0.4630	0.8547	4.94e-24
21	7d4i:3A	216	88	0.3969	0.3565	0.8750	1.38e-19
22	5tzs:2	126	29	0.1495	0.2302	1.0000	1.82e-08

[Back]