Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
gucccucuccaaacgagagaacaugcaugggcuggcaugagcggcgaggggcagucccgaggcgcugaaccuugaggccu
caugcucagggac

The query sequence (length=93) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5t2a:H 93 93 1.0000 1.0000 1.0000 2.05e-44
2 6az3:5 97 94 0.9570 0.9175 0.9468 1.61e-35
3 8a3w:5 98 95 0.9570 0.9082 0.9368 2.08e-34
4 5t5h:H 91 86 0.8710 0.8901 0.9419 4.49e-31
5 8a98:5 111 106 0.9785 0.8198 0.8585 9.80e-23
6 8rxx:L5 122 45 0.4839 0.3689 1.0000 9.87e-18
7 8rxh:L5 120 45 0.4839 0.3750 1.0000 9.87e-18
8 8ovj:5 115 45 0.4839 0.3913 1.0000 9.87e-18
9 3jcs:5 80 45 0.4839 0.5625 1.0000 9.87e-18

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417