guagcaugcuacgucauucuccacgcgaagca
The query sequence (length=32) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7uoe:T | 37 | 32 | 1.0000 | 0.8649 | 1.0000 | 3.38e-11 | |
| 2 | 7uob:T | 36 | 32 | 1.0000 | 0.8889 | 1.0000 | 3.38e-11 | |
| 3 | 7uob:P | 33 | 32 | 1.0000 | 0.9697 | 1.0000 | 3.38e-11 | 7uoe:P |
| 4 | 8sq9:T | 35 | 32 | 1.0000 | 0.9143 | 1.0000 | 3.38e-11 | 7uo9:T |
| 5 | 8sq9:P | 32 | 32 | 1.0000 | 1.0000 | 1.0000 | 3.38e-11 | 7uo9:P |
| 6 | 8sqj:T | 35 | 30 | 0.9375 | 0.8571 | 1.0000 | 4.38e-10 | 8sqk:T |
| 7 | 8sqj:P | 32 | 30 | 0.9375 | 0.9375 | 1.0000 | 4.38e-10 | 8sqk:P |
zhanggroup.org