BioLiP

>rna
gguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaaucugagauuuuuugagg
ccuugcuuuggcaaggcu

The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8ch6:e	98	98	1.0000	1.0000	1.0000	3.63e-47	7qtt:e
2	8qzs:5	109	103	1.0000	0.8991	0.9515	6.12e-40	8y6o:B
3	8i0p:B	98	98	0.9592	0.9592	0.9592	6.12e-40	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
4	8r09:5	112	106	1.0000	0.8750	0.9245	4.76e-36	8r0b:5, 8rm5:5
5	7w59:B	84	86	0.8367	0.9762	0.9535	2.87e-33	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
6	9fmd:5	92	97	0.9184	0.9783	0.9278	2.87e-33	8ro2:5
7	7dvq:B	90	86	0.8367	0.9111	0.9535	2.87e-33
8	8h6e:5A	114	109	1.0000	0.8596	0.8991	1.33e-31	8h6j:5A
9	6ah0:B	115	109	1.0000	0.8522	0.8991	1.33e-31	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
10	8q7q:5	104	103	0.9490	0.8942	0.9029	1.73e-30	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
11	6zym:5	74	70	0.7041	0.9324	0.9857	2.23e-29
12	8qpk:5	77	70	0.7041	0.8961	0.9857	2.23e-29
13	8qoz:5	79	70	0.7041	0.8734	0.9857	2.23e-29	8qpa:5, 8qpb:5
14	6id0:B	98	70	0.7041	0.7041	0.9857	2.23e-29	6id1:B
15	6icz:B	97	70	0.7041	0.7113	0.9857	2.23e-29
16	8c6j:5	113	70	0.7041	0.6106	0.9857	2.23e-29
17	7abg:5	114	70	0.7041	0.6053	0.9857	2.23e-29	7abi:5, 5mqf:5, 5o9z:5
18	6qdv:5	75	78	0.7551	0.9867	0.9487	2.89e-28
19	7aav:5	69	68	0.6837	0.9710	0.9853	2.89e-28
20	6ff4:5	70	67	0.6735	0.9429	0.9851	1.04e-27	6ff7:5
21	7abf:5	58	58	0.5918	1.0000	1.0000	6.25e-25
22	8qp8:5	71	70	0.6531	0.9014	0.9143	6.30e-20	8qp9:5
23	8ro1:5	111	39	0.3776	0.3333	0.9487	4.94e-11
24	8ro0:5	111	39	0.3776	0.3333	0.9487	4.94e-11

[Back]