BioLiP

>rna
gguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucugagucuuaaccca
auuuuuugaggccuugc

The query sequence (length=97) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6id0:B	98	97	1.0000	0.9898	1.0000	1.29e-46	6id1:B
2	6icz:B	97	97	1.0000	1.0000	1.0000	1.29e-46
3	8h6e:5A	114	97	1.0000	0.8509	1.0000	1.29e-46	8h6j:5A
4	6ah0:B	115	97	1.0000	0.8435	1.0000	1.29e-46	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
5	8c6j:5	113	97	0.9897	0.8496	0.9897	2.16e-44
6	7abg:5	114	97	0.9897	0.8421	0.9897	2.16e-44	7abi:5, 5mqf:5, 5o9z:5
7	8r09:5	112	97	0.9691	0.8393	0.9691	1.68e-40	8r0b:5, 8rm5:5
8	8qzs:5	109	97	0.9381	0.8349	0.9381	6.09e-35	8y6o:B
9	8qoz:5	79	74	0.7629	0.9367	1.0000	7.87e-34	8qpa:5, 8qpb:5
10	8qpk:5	77	72	0.7423	0.9351	1.0000	1.02e-32
11	6zym:5	74	70	0.7216	0.9459	1.0000	1.32e-31
12	7aav:5	69	68	0.7010	0.9855	1.0000	1.70e-30
13	6ff4:5	70	67	0.6907	0.9571	1.0000	6.13e-30	6ff7:5
14	8ch6:e	98	70	0.7113	0.7041	0.9857	2.20e-29	7qtt:e
15	7w59:B	84	64	0.6598	0.7619	1.0000	2.85e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
16	8i0p:B	98	64	0.6598	0.6531	1.0000	2.85e-28	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
17	7dvq:B	90	64	0.6598	0.7111	1.0000	2.85e-28
18	6qdv:5	75	63	0.6495	0.8400	1.0000	1.03e-27
19	9fmd:5	92	61	0.6289	0.6630	1.0000	1.33e-26	8ro2:5
20	8q7q:5	104	97	0.8866	0.8269	0.8866	6.17e-25	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
21	7abf:5	58	58	0.5979	1.0000	1.0000	6.17e-25
22	8qp8:5	71	71	0.6804	0.9296	0.9296	3.71e-22	8qp9:5
23	8ro1:5	111	52	0.4742	0.4144	0.8846	4.87e-11
24	8ro0:5	111	52	0.4742	0.4144	0.8846	4.87e-11

[Back]