BioLiP

>rna
gguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaaccccaauuuuuugaggc
cuugcuuuggcaaggcua

The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8i0p:B	98	98	1.0000	1.0000	1.0000	3.63e-47	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
2	8ch6:e	98	98	0.9592	0.9592	0.9592	6.12e-40	7qtt:e
3	8qzs:5	109	104	1.0000	0.8991	0.9423	7.92e-39	8y6o:B
4	7w59:B	84	85	0.8571	1.0000	0.9882	1.02e-37	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
5	7dvq:B	90	85	0.8571	0.9333	0.9882	1.02e-37
6	9fmd:5	92	96	0.9286	0.9891	0.9479	1.32e-36	8ro2:5
7	8r09:5	112	107	1.0000	0.8750	0.9159	2.22e-34	8r0b:5, 8rm5:5
8	6qdv:5	75	77	0.7653	1.0000	0.9740	1.33e-31
9	8h6e:5A	114	110	1.0000	0.8596	0.8909	1.73e-30	8h6j:5A
10	6ah0:B	115	110	1.0000	0.8522	0.8909	1.73e-30	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
11	8q7q:5	104	104	0.9490	0.8942	0.8942	8.03e-29	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
12	6zym:5	74	64	0.6531	0.8649	1.0000	2.89e-28
13	8qpk:5	77	64	0.6531	0.8312	1.0000	2.89e-28
14	8qoz:5	79	64	0.6531	0.8101	1.0000	2.89e-28	8qpa:5, 8qpb:5
15	6id0:B	98	64	0.6531	0.6531	1.0000	2.89e-28	6id1:B
16	6icz:B	97	64	0.6531	0.6598	1.0000	2.89e-28
17	6ff4:5	70	64	0.6531	0.9143	1.0000	2.89e-28	6ff7:5
18	8c6j:5	113	64	0.6531	0.5664	1.0000	2.89e-28
19	7abg:5	114	64	0.6531	0.5614	1.0000	2.89e-28	7abi:5, 5mqf:5, 5o9z:5
20	7aav:5	69	64	0.6531	0.9275	1.0000	2.89e-28
21	7abf:5	58	58	0.5918	1.0000	1.0000	6.25e-25
22	8qp8:5	71	64	0.6020	0.8310	0.9219	2.93e-18	8qp9:5
23	8ro1:5	111	39	0.3776	0.3333	0.9487	4.94e-11
24	8ro0:5	111	39	0.3776	0.3333	0.9487	4.94e-11

[Back]