gguugcucgacugugagaggaccuacccacuguggaaacaccacaggaacuuccaaccuucggguggcgagguagggcag
aagagugacc
The query sequence (length=90) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8t2a:R | 90 | 90 | 1.0000 | 1.0000 | 1.0000 | 9.14e-43 | |
| 2 | 8t2o:R | 90 | 90 | 0.9889 | 0.9889 | 0.9889 | 4.25e-41 | |
| 3 | 8t2b:R | 90 | 90 | 0.9889 | 0.9889 | 0.9889 | 4.25e-41 | |
| 4 | 8t29:R | 90 | 90 | 0.9889 | 0.9889 | 0.9889 | 4.25e-41 |
umich.edu