ggucaauuugaaacaauacagagaugaucagcagccguuuuacaaagagacc
The query sequence (length=52) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5tf6:D | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 5.83e-22 | |
| 2 | 5y88:D | 101 | 34 | 0.6538 | 0.3366 | 1.0000 | 5.92e-12 | |
| 3 | 5tf6:B | 71 | 34 | 0.6538 | 0.4789 | 1.0000 | 5.92e-12 | |
| 4 | 5mps:6 | 99 | 34 | 0.6538 | 0.3434 | 1.0000 | 5.92e-12 | 5mq0:6 |
| 5 | 5lj3:V | 97 | 34 | 0.6538 | 0.3505 | 1.0000 | 5.92e-12 | 5lj5:V |
| 6 | 7dco:F | 103 | 34 | 0.6538 | 0.3301 | 1.0000 | 5.92e-12 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
| 7 | 7b9v:6 | 102 | 34 | 0.6538 | 0.3333 | 1.0000 | 5.92e-12 | 6bk8:6, 6exn:6, 5lqw:6 |
| 8 | 4n0t:B | 65 | 32 | 0.6154 | 0.4923 | 1.0000 | 7.66e-11 | |
| 9 | 6aso:I | 70 | 29 | 0.5577 | 0.4143 | 1.0000 | 3.56e-09 | |
| 10 | 5vsu:I | 73 | 28 | 0.5385 | 0.3836 | 1.0000 | 1.28e-08 |
zhanggroup.org