gguaaaacagccugugggugaaacacacccacagggcccauugggcgcuagcacucugguaucaccguaccuuugugcgc
cuguuuuacc
The query sequence (length=90) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8dp3:R | 90 | 90 | 1.0000 | 1.0000 | 1.0000 | 9.14e-43 | |
| 2 | 8vm8:R | 93 | 93 | 0.9444 | 0.9140 | 0.9140 | 5.58e-30 |
umich.edu