ggguccgccuugagugcccgggugagaagcaugaucccggguaauuauggcggacccacag
The query sequence (length=61) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2hvy:E | 61 | 61 | 1.0000 | 1.0000 | 1.0000 | 7.33e-27 | |
| 2 | 3hay:E | 69 | 61 | 1.0000 | 0.8841 | 1.0000 | 7.33e-27 | |
| 3 | 3hax:E | 60 | 61 | 0.9836 | 1.0000 | 0.9836 | 1.23e-24 |
zhanggroup.org