gggguaucgccaagcgguaaggcaccgguuuuugauaccggccgcagguucgaauccugcuaccccagcca
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4jxz:B | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
2 | 4jyz:B | 72 | 72 | 1.0000 | 0.9861 | 0.9861 | 1.14e-30 | |
3 | 4jxx:B | 71 | 71 | 0.9014 | 0.9014 | 0.9014 | 1.15e-20 | |
4 | 1euq:B | 72 | 72 | 0.9155 | 0.9028 | 0.9028 | 1.15e-20 | |
5 | 1euy:B | 73 | 73 | 0.9155 | 0.8904 | 0.8904 | 1.49e-19 | |
6 | 1exd:B | 73 | 73 | 0.9014 | 0.8767 | 0.8767 | 6.93e-18 | |
7 | 4v7l:AY | 75 | 74 | 0.9014 | 0.8533 | 0.8649 | 3.23e-16 | 4v7l:CY, 4v7m:AY, 4v7m:CY |
8 | 5nwy:M | 75 | 74 | 0.9014 | 0.8533 | 0.8649 | 3.23e-16 | 7qg8:M, 7qgh:M, 7qgn:M, 7qgr:M, 4v7l:CW |
9 | 1gtr:B | 74 | 74 | 0.9014 | 0.8649 | 0.8649 | 3.23e-16 | 1gts:B, 1o0b:B, 1o0c:B, 1qrs:B, 1qrt:B, 1qru:B, 1qtq:B, 2rd2:B, 2re8:B, 4v7m:CW, 1zjw:B |