ggggcuauagcucagcugggagagcgccugcuuugcacgcaggaggucugcgguucgaucccgcauagcuccacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6q9a:7 | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 8qbt:7, 8vs9:ATRN, 8vsa:ATRN |
| 2 | 7aqc:T | 76 | 77 | 0.9474 | 0.9474 | 0.9351 | 9.69e-27 | 7aqd:T |
| 3 | 7as9:2 | 75 | 77 | 0.9342 | 0.9467 | 0.9221 | 1.62e-24 | |
| 4 | 7as8:2 | 73 | 77 | 0.9079 | 0.9452 | 0.8961 | 1.26e-20 |
zhanggroup.org