ggggccuuagcucagcugggagagcgccugcuuugcacgcaggaggucagcgguucgaucccgcuaggcuccacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7aqc:T | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 7aqd:T |
2 | 7as9:2 | 75 | 76 | 0.9868 | 1.0000 | 0.9868 | 7.44e-33 | |
3 | 7as8:2 | 73 | 76 | 0.9605 | 1.0000 | 0.9605 | 5.79e-29 | |
4 | 6q9a:7 | 76 | 77 | 0.9474 | 0.9474 | 0.9351 | 9.69e-27 | 8qbt:7, 8vs9:ATRN, 8vsa:ATRN |
5 | 7ope:2 | 70 | 76 | 0.9211 | 1.0000 | 0.9211 | 2.10e-23 | |
6 | 8s1u:c | 66 | 72 | 0.8684 | 1.0000 | 0.9167 | 3.51e-21 | |
7 | 7aqc:P | 69 | 76 | 0.9079 | 1.0000 | 0.9079 | 3.51e-21 | 8s1p:a, 8s1u:a |