gggcuuguagcucaggugguuagagcgcaccccugauaagggugaggucggugguucaaguccacucaggcccac
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1ffy:T | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 1qu2:T, 1qu3:T |
| 2 | 8zyc:C | 73 | 71 | 0.9467 | 0.9726 | 1.0000 | 2.63e-32 | 8zyd:C |
| 3 | 5o2r:x | 77 | 71 | 0.9467 | 0.9221 | 1.0000 | 2.63e-32 | |
| 4 | 7b5k:x | 77 | 71 | 0.9333 | 0.9091 | 0.9859 | 1.22e-30 | |
| 5 | 8vu0:C | 76 | 73 | 0.9200 | 0.9079 | 0.9452 | 1.23e-25 | 8vu0:D |
| 6 | 5kcs:1x | 73 | 71 | 0.8933 | 0.9178 | 0.9437 | 1.59e-24 |
umich.edu