gggcccuuagcuuagucugguuaaagcgaucggcucauaaccgauugagcgcugguucgaauccggcagggcccacca
The query sequence (length=78) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8htz:X | 78 | 78 | 1.0000 | 1.0000 | 1.0000 | 3.56e-36 | |
| 2 | 4v8n:AV | 78 | 78 | 0.9872 | 0.9872 | 0.9872 | 1.66e-34 | 4v8n:AW, 4v8n:AY, 4v8n:CV, 4v8n:CW, 4v8n:CY |
zhanggroup.org