BioLiP

>rna
gggauuuagcucaguugggagagcgccagacugaagaucuggagguccuguguucgauccacagaauccccac

The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5axm:P	73	73	1.0000	1.0000	1.0000	1.96e-33
2	6xir:AZ	73	66	0.9041	0.9041	1.0000	1.53e-29
3	4v65:AA	75	66	0.9041	0.8800	1.0000	1.53e-29	4v65:AP, 4v66:AP
4	1ob5:B	76	66	0.9041	0.8684	1.0000	1.53e-29	1ob5:D, 1ob5:F
5	1ob2:B	76	66	0.9041	0.8684	1.0000	1.53e-29
6	6lvr:D	72	66	0.9041	0.9167	1.0000	1.53e-29	6lvr:B
7	8cth:C	74	66	0.9041	0.8919	1.0000	1.53e-29
8	8ccs:Bb	76	66	0.9041	0.8684	1.0000	1.53e-29	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
9	6ah3:T	80	66	0.9041	0.8250	1.0000	1.53e-29
10	4v4i:0	76	66	0.8904	0.8553	0.9848	7.10e-28	4v4j:2
11	6gz3:Bw	76	64	0.8630	0.8289	0.9844	9.18e-27	6gz4:Bw, 6gz5:Bw
12	3wc2:Q	73	66	0.8767	0.8767	0.9697	3.30e-26
13	3wc2:P	74	66	0.8767	0.8649	0.9697	3.30e-26
14	4v68:AY	72	66	0.8493	0.8611	0.9394	9.25e-22
15	5axn:P	66	73	0.9041	1.0000	0.9041	1.55e-19

[Back]