gggaaauuaggugcgcuggggguuucaguugcgccgaaaggcgcucuguaaucauuaaaaaguauuuugaacggaccucu
guuugacacgucug
The query sequence (length=94) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5b2p:B | 94 | 94 | 1.0000 | 1.0000 | 1.0000 | 5.77e-45 | |
2 | 5b2o:B | 94 | 94 | 0.9894 | 0.9894 | 0.9894 | 2.68e-43 | 5b2q:B |