ggcuauguagcucaguugguuagagcaccgcacucauaaugcgggggucacaaguucaagucucgucauagccacca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7m4x:v | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 7m4y:v, 7ryf:v, 7ryg:v, 7uvv:v, 7uvw:v, 7uvy:v, 7uvz:v, 6v39:v |
zhanggroup.org