ggcgcguuaacaaagcgguuauguagcggauugcaaauccgucuaguccgguucgacuccggaacgcgccucca
The query sequence (length=74) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1b23:R | 74 | 74 | 1.0000 | 1.0000 | 1.0000 | 5.55e-34 | 1u0b:A |
| 2 | 7zta:ATR1 | 68 | 71 | 0.9189 | 1.0000 | 0.9577 | 3.36e-26 |
zhanggroup.org