BioLiP

>rna
ggccuccgaacgguaagagccuagcauguagaacuuuuccuugaugaugucauacuuauccugucccuuuuuuuucc

The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6ahd:G	77	77	1.0000	1.0000	1.0000	1.26e-35
2	5z56:G	77	78	0.9481	0.9481	0.9359	2.74e-27	5z57:G, 5z58:G
3	8i0u:G	79	78	0.9481	0.9241	0.9359	2.74e-27	8i0v:G
4	8ch6:g	76	77	0.9221	0.9342	0.9221	1.65e-24	7qtt:g
5	8i0s:G	72	77	0.9091	0.9722	0.9091	9.94e-22	8i0t:G
6	8i0r:G	71	77	0.9091	0.9859	0.9091	9.94e-22
7	6ah0:G	42	42	0.5455	1.0000	1.0000	3.60e-16
8	5yzg:G	88	35	0.4545	0.3977	1.0000	2.80e-12
9	5yzg:G	88	33	0.4286	0.3750	1.0000	3.62e-11
10	5xjc:G	84	35	0.4545	0.4167	1.0000	2.80e-12
11	5xjc:G	84	29	0.3766	0.3452	1.0000	6.06e-09
12	6icz:G	84	35	0.4545	0.4167	1.0000	2.80e-12
13	6icz:G	84	31	0.4026	0.3690	1.0000	4.69e-10
14	8i0p:G	63	74	0.8182	1.0000	0.8514	2.80e-12
15	6id1:G	68	34	0.4416	0.5000	1.0000	1.01e-11
16	8i0w:6	70	33	0.4286	0.4714	1.0000	3.62e-11	6id0:G
17	8qo9:Z	46	31	0.4026	0.6739	1.0000	4.69e-10
18	8q7n:Z	31	31	0.4026	1.0000	1.0000	4.69e-10
19	7abi:Z	57	30	0.3896	0.5263	1.0000	1.69e-09
20	7abg:Z	47	30	0.3896	0.6383	1.0000	1.69e-09
21	7w59:G	82	29	0.3766	0.3537	1.0000	6.06e-09	7w5a:G, 7w5b:G
22	7aav:Z	29	29	0.3766	1.0000	1.0000	6.06e-09	7abf:Z

[Back]