Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
ggccuccgaacgguaagagccuagcauguagaacugguuaccuccaggguuuccuugaugaugucauacuuauccugucc
acag

The query sequence (length=84) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 6icz:G 84 84 1.0000 1.0000 1.0000 1.81e-39
2 5yzg:G 88 80 0.9524 0.9091 1.0000 3.03e-37
3 5xjc:G 84 78 0.9286 0.9286 1.0000 3.92e-36
4 8i0w:6 70 68 0.8095 0.9714 1.0000 1.42e-30 6id0:G
5 7w59:G 82 66 0.7857 0.8049 1.0000 1.84e-29 7w5a:G, 7w5b:G
6 6id1:G 68 68 0.7738 0.9559 0.9559 1.85e-24
7 5z56:G 77 43 0.5119 0.5584 1.0000 1.12e-16 5z57:G, 5z58:G
8 8i0u:G 79 43 0.5119 0.5443 1.0000 1.12e-16 8i0v:G
9 8ch6:g 76 40 0.4762 0.5263 1.0000 5.22e-15 7qtt:g
10 8i0s:G 72 36 0.4286 0.5000 1.0000 8.73e-13 8i0t:G
11 8i0r:G 71 36 0.4286 0.5070 1.0000 8.73e-13
12 6ahd:G 77 35 0.4167 0.4545 1.0000 3.14e-12
13 6ahd:G 77 31 0.3690 0.4026 1.0000 5.25e-10
14 8qo9:Z 46 31 0.3690 0.6739 1.0000 5.25e-10
15 8q7n:Z 31 31 0.3690 1.0000 1.0000 5.25e-10
16 6ah0:G 42 31 0.3690 0.7381 1.0000 5.25e-10
17 8i0p:G 63 30 0.3571 0.4762 1.0000 1.89e-09
18 7abi:Z 57 30 0.3571 0.5263 1.0000 1.89e-09
19 7abg:Z 47 30 0.3571 0.6383 1.0000 1.89e-09
20 7aav:Z 29 29 0.3452 1.0000 1.0000 6.80e-09 7abf:Z

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417