ggccuccgaacgguaagagccuagcauguagaacugguuaccuaugaugucauacuuauccugucccuuuuuuuucc
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5z56:G | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 5z57:G, 5z58:G |
2 | 8i0u:G | 79 | 77 | 1.0000 | 0.9747 | 1.0000 | 1.26e-35 | 8i0v:G |
3 | 8ch6:g | 76 | 77 | 0.9481 | 0.9605 | 0.9481 | 7.63e-28 | 7qtt:g |
4 | 6ahd:G | 77 | 78 | 0.9481 | 0.9481 | 0.9359 | 2.74e-27 | |
5 | 8i0s:G | 72 | 77 | 0.9091 | 0.9722 | 0.9091 | 9.94e-22 | 8i0t:G |
6 | 8i0r:G | 71 | 77 | 0.9091 | 0.9859 | 0.9091 | 9.94e-22 | |
7 | 5yzg:G | 88 | 43 | 0.5584 | 0.4886 | 1.0000 | 1.00e-16 | |
8 | 5xjc:G | 84 | 43 | 0.5584 | 0.5119 | 1.0000 | 1.00e-16 | |
9 | 6icz:G | 84 | 43 | 0.5584 | 0.5119 | 1.0000 | 1.00e-16 | |
10 | 8i0p:G | 63 | 74 | 0.8182 | 1.0000 | 0.8514 | 2.80e-12 | |
11 | 7w59:G | 82 | 31 | 0.4026 | 0.3780 | 1.0000 | 4.69e-10 | 7w5a:G, 7w5b:G |
12 | 8qo9:Z | 46 | 31 | 0.4026 | 0.6739 | 1.0000 | 4.69e-10 | |
13 | 8q7n:Z | 31 | 31 | 0.4026 | 1.0000 | 1.0000 | 4.69e-10 | |
14 | 8i0w:6 | 70 | 31 | 0.4026 | 0.4429 | 1.0000 | 4.69e-10 | 6id0:G |
15 | 6id1:G | 68 | 30 | 0.3896 | 0.4412 | 1.0000 | 1.69e-09 | |
16 | 7abi:Z | 57 | 30 | 0.3896 | 0.5263 | 1.0000 | 1.69e-09 | |
17 | 7abg:Z | 47 | 30 | 0.3896 | 0.6383 | 1.0000 | 1.69e-09 | |
18 | 7aav:Z | 29 | 29 | 0.3766 | 1.0000 | 1.0000 | 6.06e-09 | 7abf:Z |