ggauugaaacgccaugcucaggcuggcgagugggcgccacucucca
The query sequence (length=46) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8dfa:L | 46 | 46 | 1.0000 | 1.0000 | 1.0000 | 1.04e-18 | |
| 2 | 8dej:L | 47 | 46 | 1.0000 | 0.9787 | 1.0000 | 1.04e-18 | |
| 3 | 8dfo:L | 45 | 42 | 0.8913 | 0.9111 | 0.9762 | 8.10e-15 | |
| 4 | 8dex:L | 48 | 42 | 0.8913 | 0.8542 | 0.9762 | 8.10e-15 | 8dfs:L |
| 5 | 7kha:J | 45 | 42 | 0.8696 | 0.8889 | 0.9524 | 1.36e-12 |
umich.edu