ggaugauccucaguggucuggggugcaagcugucuagcgacagagugguucaauuccaccuuu
The query sequence (length=63) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4rqf:C | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 5.79e-28 | |
| 2 | 3hl2:E | 82 | 70 | 1.0000 | 0.7683 | 0.9000 | 5.87e-18 | |
| 3 | 7mdl:E | 84 | 72 | 1.0000 | 0.7500 | 0.8750 | 3.53e-15 | |
| 4 | 7zjw:F | 90 | 36 | 0.5714 | 0.4000 | 1.0000 | 5.91e-13 | |
| 5 | 4rqe:D | 83 | 36 | 0.5714 | 0.4337 | 1.0000 | 5.91e-13 | |
| 6 | 4rqe:B | 84 | 36 | 0.5714 | 0.4286 | 1.0000 | 5.91e-13 | |
| 7 | 8g9z:E | 87 | 36 | 0.5714 | 0.4138 | 1.0000 | 5.91e-13 |
zhanggroup.org