ggaaacuggguauaggugaaacacaccuguaccacccacgugguguagugcuccuguauugguacacuugcacgccaguu
ucc
The query sequence (length=83) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8vmb:R | 83 | 83 | 1.0000 | 1.0000 | 1.0000 | 6.41e-39 | |
| 2 | 8vma:C | 88 | 88 | 0.9157 | 0.8636 | 0.8636 | 5.10e-20 | 8vma:R |
umich.edu