ggaaacggccuccgaacgguaagagccuagcauguagaacugguuaccuccaggguuuccuugaugaugucauacuuauc
cugu
The query sequence (length=84) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5yzg:G | 88 | 84 | 1.0000 | 0.9545 | 1.0000 | 1.81e-39 | |
2 | 5xjc:G | 84 | 84 | 1.0000 | 1.0000 | 1.0000 | 1.81e-39 | |
3 | 6icz:G | 84 | 78 | 0.9286 | 0.9286 | 1.0000 | 3.92e-36 | |
4 | 7w59:G | 82 | 66 | 0.7857 | 0.8049 | 1.0000 | 1.84e-29 | 7w5a:G, 7w5b:G |
5 | 8i0w:6 | 70 | 66 | 0.7857 | 0.9429 | 1.0000 | 1.84e-29 | 6id0:G |
6 | 6id1:G | 68 | 66 | 0.7500 | 0.9265 | 0.9545 | 2.39e-23 | |
7 | 8i0u:G | 79 | 44 | 0.5238 | 0.5570 | 1.0000 | 3.12e-17 | 8i0v:G |
8 | 5z56:G | 77 | 43 | 0.5119 | 0.5584 | 1.0000 | 1.12e-16 | 5z57:G, 5z58:G |
9 | 8ch6:g | 76 | 41 | 0.4881 | 0.5395 | 1.0000 | 1.45e-15 | 7qtt:g |
10 | 8i0s:G | 72 | 37 | 0.4405 | 0.5139 | 1.0000 | 2.43e-13 | 8i0t:G |
11 | 8i0r:G | 71 | 37 | 0.4405 | 0.5211 | 1.0000 | 2.43e-13 | |
12 | 6ahd:G | 77 | 35 | 0.4167 | 0.4545 | 1.0000 | 3.14e-12 | |
13 | 6ahd:G | 77 | 29 | 0.3452 | 0.3766 | 1.0000 | 6.80e-09 | |
14 | 8qo9:Z | 46 | 31 | 0.3690 | 0.6739 | 1.0000 | 5.25e-10 | |
15 | 8q7n:Z | 31 | 31 | 0.3690 | 1.0000 | 1.0000 | 5.25e-10 | |
16 | 8i0p:G | 63 | 30 | 0.3571 | 0.4762 | 1.0000 | 1.89e-09 | |
17 | 7abi:Z | 57 | 30 | 0.3571 | 0.5263 | 1.0000 | 1.89e-09 | |
18 | 7abg:Z | 47 | 30 | 0.3571 | 0.6383 | 1.0000 | 1.89e-09 | |
19 | 6ah0:G | 42 | 29 | 0.3452 | 0.6905 | 1.0000 | 6.80e-09 | |
20 | 7aav:Z | 29 | 29 | 0.3452 | 1.0000 | 1.0000 | 6.80e-09 | 7abf:Z |