BioLiP

>rna
gcggauuuagcucaguugggagagcgccagacugaagaucuggagguccuguguucgauccacagaauucgcacafc

The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	1ob5:B	76	76	0.9870	1.0000	1.0000	4.45e-35	1ob5:D, 1ob5:F
2	4v65:AA	75	74	0.9610	0.9867	1.0000	5.75e-34	4v65:AP, 4v66:AP
3	1ob2:B	76	74	0.9610	0.9737	1.0000	5.75e-34
4	8cth:C	74	74	0.9610	1.0000	1.0000	5.75e-34
5	8ccs:Bb	76	74	0.9610	0.9737	1.0000	5.75e-34	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
6	6xir:AZ	73	73	0.9481	1.0000	1.0000	2.07e-33
7	6ah3:T	80	73	0.9481	0.9125	1.0000	2.07e-33
8	6lvr:D	72	72	0.9351	1.0000	1.0000	7.44e-33	6lvr:B
9	4v4i:0	76	74	0.9481	0.9605	0.9865	2.68e-32	4v4j:2
10	3wc2:P	74	74	0.9351	0.9730	0.9730	1.25e-30
11	6gz3:Bw	76	74	0.9351	0.9474	0.9730	1.25e-30	6gz4:Bw, 6gz5:Bw
12	3wc2:Q	73	73	0.9221	0.9726	0.9726	4.48e-30
13	5axm:P	73	66	0.8571	0.9041	1.0000	1.61e-29
14	4v68:AY	72	74	0.9091	0.9722	0.9459	3.49e-26
15	4cxg:Y	76	74	0.8701	0.8816	0.9054	2.71e-22	4cxh:Y
16	5axn:P	66	66	0.7662	0.8939	0.8939	1.27e-15
17	8bsj:x	74	76	0.8312	0.8649	0.8421	2.13e-13
18	3icq:D	62	33	0.4286	0.5323	1.0000	3.56e-11
19	3icq:E	62	32	0.4156	0.5161	1.0000	1.28e-10

[Back]