BioLiP

>rna
gcggauuuacucagaagggagagcaccagaauaucaaaauggaguccuguguucgauccacagaauucgcacca

The query sequence (length=74) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8bsj:x	74	74	1.0000	1.0000	1.0000	5.55e-34
2	4v4i:0	76	76	0.8784	0.8553	0.8553	3.41e-16	4v4j:2
3	3wc2:P	74	74	0.8514	0.8514	0.8514	4.41e-15
4	3wc2:Q	73	73	0.8378	0.8493	0.8493	1.59e-14
5	1ob2:B	76	78	0.8919	0.8684	0.8462	1.59e-14
6	4cxg:Y	76	78	0.8919	0.8684	0.8462	1.59e-14	4cxh:Y
7	8ccs:Bb	76	78	0.8919	0.8684	0.8462	1.59e-14	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
8	4v65:AA	75	77	0.8784	0.8667	0.8442	5.71e-14	4v65:AP, 4v66:AP
9	1ob5:B	76	76	0.8649	0.8421	0.8421	2.05e-13	1ob5:D, 1ob5:F
10	8cth:C	74	76	0.8649	0.8649	0.8421	2.05e-13
11	6xir:AZ	73	75	0.8514	0.8630	0.8400	7.39e-13
12	6ah3:T	80	75	0.8514	0.7875	0.8400	7.39e-13
13	4v68:AY	72	36	0.4730	0.4861	0.9722	1.24e-10
14	3icq:E	62	31	0.4189	0.5000	1.0000	4.45e-10
15	3icq:D	62	35	0.4595	0.5484	0.9714	4.45e-10

[Back]