gccgggguggcggaauggguagacgcgcaugacaucaugugcgcaagcgugcggguucaagucccgcccccggcacca
The query sequence (length=78) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2bte:B | 78 | 78 | 1.0000 | 1.0000 | 1.0000 | 3.56e-36 | 2bte:E, 2byt:B, 2byt:E |
| 2 | 2v0g:B | 76 | 78 | 0.9744 | 1.0000 | 0.9744 | 2.77e-32 | 2v0g:F |
umich.edu