gccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcugaggcuggaggaucgcuuuagcgagaccccguc
ucgacuaaguucggcaucaauauggugaccucccgggagcgggggaccaccagguugccuaaggaggggugaaccggccc
aggucggaaacggagcaggucaaaacucccgugcugaucaguaguu
The query sequence (length=206) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3jaj:4 | 206 | 206 | 1.0000 | 1.0000 | 1.0000 | 7.84e-107 | 3jan:4 |
2 | 7nfx:1 | 249 | 211 | 0.9612 | 0.7952 | 0.9384 | 1.04e-85 | 7obr:1 |
3 | 6frk:1 | 258 | 215 | 0.9660 | 0.7713 | 0.9256 | 2.26e-82 | |
4 | 6r6g:AF | 206 | 206 | 0.9175 | 0.9175 | 0.9175 | 1.77e-73 | |
5 | 4p3e:A | 124 | 124 | 0.6019 | 1.0000 | 1.0000 | 3.01e-61 | |
6 | 4ue5:A | 299 | 129 | 0.6165 | 0.4247 | 0.9845 | 3.89e-60 | |
7 | 4ue5:A | 299 | 69 | 0.3252 | 0.2241 | 0.9710 | 2.44e-27 | |
8 | 7qwq:1 | 167 | 129 | 0.6165 | 0.7605 | 0.9845 | 3.89e-60 | |
9 | 7obq:1 | 165 | 129 | 0.6165 | 0.7697 | 0.9845 | 3.89e-60 | |
10 | 5m73:A | 145 | 129 | 0.6165 | 0.8759 | 0.9845 | 3.89e-60 | 5m73:E |
11 | 2j37:A | 128 | 122 | 0.5922 | 0.9531 | 1.0000 | 3.89e-60 | 1mfq:A, 1ry1:A |
12 | 2go5:A | 127 | 122 | 0.5922 | 0.9606 | 1.0000 | 3.89e-60 | |
13 | 1l9a:B | 126 | 122 | 0.5825 | 0.9524 | 0.9836 | 3.03e-56 | |
14 | 3ktv:A | 108 | 105 | 0.5097 | 0.9722 | 1.0000 | 1.10e-50 | 3ktv:C |
15 | 1ry1:E | 49 | 47 | 0.2282 | 0.9592 | 1.0000 | 1.91e-18 | |
16 | 1e8o:E | 50 | 47 | 0.2282 | 0.9400 | 1.0000 | 1.91e-18 |