gccgaucaaucgcccccggggugcgcggcugggggcucgcagggccccuccgucccccuaagcgcagac
The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8fkp:L2 | 69 | 69 | 1.0000 | 1.0000 | 1.0000 | 3.04e-31 | 8fkq:L2, 8fkr:L2, 8fks:L2, 8fkt:L2, 8fku:L2, 8fkv:L2, 8fkw:L2, 8fkx:L2, 8fky:L2 |
2 | 8fl2:L2 | 72 | 68 | 0.9855 | 0.9444 | 1.0000 | 1.09e-30 | 8fl6:L2, 8fla:L2, 8fld:L2 |
3 | 8fkz:L2 | 68 | 68 | 0.9855 | 1.0000 | 1.0000 | 1.09e-30 |