gccgaggugguggaauugguagacacgcuaccuugaggugguaguuuacggguucaagucccguccucgguacca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6ha8:x | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | |
2 | 4wsm:3K | 77 | 77 | 1.0000 | 0.9740 | 0.9740 | 9.46e-32 | |
3 | 4wsm:2K | 79 | 79 | 1.0000 | 0.9494 | 0.9494 | 5.69e-29 | |
4 | 4wsm:2L | 80 | 80 | 1.0000 | 0.9375 | 0.9375 | 2.65e-27 | |
5 | 2nr0:F | 72 | 72 | 0.8933 | 0.9306 | 0.9306 | 7.42e-23 | |
6 | 2nr0:G | 67 | 67 | 0.8400 | 0.9403 | 0.9403 | 2.67e-22 | |
7 | 6d90:3 | 87 | 45 | 0.6000 | 0.5172 | 1.0000 | 7.47e-18 | 6d9j:3, 6ha1:x, 6htq:v, 5kcr:1x, 7nso:8, 7nsp:8, 7nsq:8, 4v87:BB, 4v87:CB, 4v8b:AB, 4v8c:CB, 4v8c:DB, 4wsm:1K, 4wsm:1L |
8 | 2nr0:H | 65 | 65 | 0.7733 | 0.8923 | 0.8923 | 2.69e-17 | |
9 | 2nr0:E | 81 | 44 | 0.5867 | 0.5432 | 1.0000 | 2.69e-17 | |
10 | 2nre:F | 56 | 64 | 0.7467 | 1.0000 | 0.8750 | 7.52e-13 |